ID: 1151310813_1151310825

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1151310813 1151310825
Species Human (GRCh38) Human (GRCh38)
Location 17:73291525-73291547 17:73291554-73291576
Sequence CCAGAGGCCTGGGCAGGTCCTGG CTATGGTTTGGGAGGCCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 77, 4: 550} {0: 1, 1: 0, 2: 1, 3: 17, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!