ID: 1151314154_1151314168

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1151314154 1151314168
Species Human (GRCh38) Human (GRCh38)
Location 17:73311637-73311659 17:73311688-73311710
Sequence CCACCTCCTCCTCCACACATCCC TAGGGTCCCAGGCACCGCGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 28, 3: 282, 4: 2220} {0: 1, 1: 0, 2: 0, 3: 11, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!