ID: 1151320312_1151320321

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1151320312 1151320321
Species Human (GRCh38) Human (GRCh38)
Location 17:73348846-73348868 17:73348860-73348882
Sequence CCTTCCTGGGTCTGCCTTCCAGG CCTTCCAGGGGCCCGGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 462} {0: 1, 1: 0, 2: 5, 3: 30, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!