ID: 1151320391_1151320394

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1151320391 1151320394
Species Human (GRCh38) Human (GRCh38)
Location 17:73349143-73349165 17:73349160-73349182
Sequence CCTTGTTACATGTAGTAGGGCCC GGGCCCCGGAGCCAGCCTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 42} {0: 1, 1: 0, 2: 8, 3: 45, 4: 432}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!