ID: 1151320672_1151320683

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1151320672 1151320683
Species Human (GRCh38) Human (GRCh38)
Location 17:73350516-73350538 17:73350546-73350568
Sequence CCTAGGCTGCCCCACCCACCAGA CGCTGCCAGGAGCCAGGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 41, 4: 372} {0: 1, 1: 0, 2: 9, 3: 73, 4: 544}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!