ID: 1151321470_1151321477

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1151321470 1151321477
Species Human (GRCh38) Human (GRCh38)
Location 17:73355033-73355055 17:73355074-73355096
Sequence CCAATTTGGGGAAGGCCATGGGG CTGTCCTTGCAGAAGGCTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 133} {0: 1, 1: 0, 2: 2, 3: 24, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!