ID: 1151327796_1151327812

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1151327796 1151327812
Species Human (GRCh38) Human (GRCh38)
Location 17:73389668-73389690 17:73389706-73389728
Sequence CCCTGATCCTGCGCCCATCTGTG CTGTGAGTGGGGAGGGGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 128} {0: 1, 1: 2, 2: 6, 3: 193, 4: 1723}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!