ID: 1151329435_1151329457

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1151329435 1151329457
Species Human (GRCh38) Human (GRCh38)
Location 17:73398263-73398285 17:73398314-73398336
Sequence CCCCCACCCACCCCCAGCCCTGA CATTACCTGTAGCAGGTGAAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 28, 3: 268, 4: 2172} {0: 1, 1: 0, 2: 1, 3: 9, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!