ID: 1151329441_1151329457

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1151329441 1151329457
Species Human (GRCh38) Human (GRCh38)
Location 17:73398270-73398292 17:73398314-73398336
Sequence CCACCCCCAGCCCTGAGGCTGCT CATTACCTGTAGCAGGTGAAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 6, 3: 125, 4: 1255} {0: 1, 1: 0, 2: 1, 3: 9, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!