ID: 1151329669_1151329684

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1151329669 1151329684
Species Human (GRCh38) Human (GRCh38)
Location 17:73399322-73399344 17:73399372-73399394
Sequence CCGGTGAGAATGGCCCCCCATGT GCTGTGTGTCACGCTTTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 73} {0: 1, 1: 0, 2: 0, 3: 17, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!