ID: 1151338716_1151338731

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1151338716 1151338731
Species Human (GRCh38) Human (GRCh38)
Location 17:73456110-73456132 17:73456161-73456183
Sequence CCCAGCTCCCAGGTTGGGAGTGG CAGGATGACCACAGGGAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 230} {0: 1, 1: 1, 2: 5, 3: 50, 4: 430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!