|
Left Crispr |
Right Crispr |
| Crispr ID |
1151340823 |
1151340828 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:73469624-73469646
|
17:73469643-73469665
|
| Sequence |
CCAGGGGAAGGGACCACACACGT |
ACGTGTCTGGCCTGGTGTGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 0, 3: 2, 4: 97} |
{0: 1, 1: 0, 2: 10, 3: 117, 4: 957} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|