ID: 1151342927_1151342931

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1151342927 1151342931
Species Human (GRCh38) Human (GRCh38)
Location 17:73483163-73483185 17:73483190-73483212
Sequence CCAGAAAGAAATTCCTCTGGGGA CCCAGGCCTTGCCTTGATGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 165} {0: 1, 1: 0, 2: 2, 3: 25, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!