ID: 1151354182_1151354193

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1151354182 1151354193
Species Human (GRCh38) Human (GRCh38)
Location 17:73548773-73548795 17:73548818-73548840
Sequence CCAACCAGGCTCTGCATGGTGGG AGCTTGCTGCTATCCCACGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 232} {0: 1, 1: 0, 2: 1, 3: 1, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!