ID: 1151356379_1151356387

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1151356379 1151356387
Species Human (GRCh38) Human (GRCh38)
Location 17:73561035-73561057 17:73561077-73561099
Sequence CCACAGGTACAGGAAAGAGGAGA TCACTCTGCCCAAGCTTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 376} {0: 1, 1: 0, 2: 0, 3: 30, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!