ID: 1151358259_1151358264

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1151358259 1151358264
Species Human (GRCh38) Human (GRCh38)
Location 17:73572959-73572981 17:73573008-73573030
Sequence CCAGGAAGCAGAGCACAGGTGTC AGTGCAGGTGTGCCACATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 250} {0: 1, 1: 0, 2: 3, 3: 8, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!