ID: 1151365015_1151365020

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1151365015 1151365020
Species Human (GRCh38) Human (GRCh38)
Location 17:73611546-73611568 17:73611564-73611586
Sequence CCCTGTGGCCTCTGCTCACATGG CATGGTAAGTGGAATGAGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 37, 4: 404} {0: 1, 1: 0, 2: 1, 3: 38, 4: 621}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!