ID: 1151365173_1151365186

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1151365173 1151365186
Species Human (GRCh38) Human (GRCh38)
Location 17:73612299-73612321 17:73612336-73612358
Sequence CCCCGCATGGTCCCCTACCCTCA CCCAGCTGCACCTGGGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 153} {0: 2, 1: 2, 2: 7, 3: 53, 4: 452}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!