ID: 1151373480_1151373484

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1151373480 1151373484
Species Human (GRCh38) Human (GRCh38)
Location 17:73665928-73665950 17:73665975-73665997
Sequence CCTAGTAGGTGTTTCATAAATCC ACTTGCCAAGTTGAGAGGTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!