ID: 1151378594_1151378598

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1151378594 1151378598
Species Human (GRCh38) Human (GRCh38)
Location 17:73708977-73708999 17:73708996-73709018
Sequence CCAACTTCCCTCTGGAGAAAATG AATGGACAGTACCAGTGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 244} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!