ID: 1151416811_1151416817

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1151416811 1151416817
Species Human (GRCh38) Human (GRCh38)
Location 17:73971949-73971971 17:73971991-73972013
Sequence CCTAATCTATAGCATGGGGTCCC CAATGAGTGCCGAGTAGAAGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!