ID: 1151431330_1151431337

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1151431330 1151431337
Species Human (GRCh38) Human (GRCh38)
Location 17:74065491-74065513 17:74065530-74065552
Sequence CCAACCAAGAAGAGGGGTCAGGC TGCACTTGTACCATAAGTTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!