ID: 1151436248_1151436255

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1151436248 1151436255
Species Human (GRCh38) Human (GRCh38)
Location 17:74099620-74099642 17:74099637-74099659
Sequence CCATTTCCCTCCTGCAGAGATCA AGATCACAGCTGGGAGATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 381} {0: 1, 1: 0, 2: 2, 3: 48, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!