ID: 1151460586_1151460591

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1151460586 1151460591
Species Human (GRCh38) Human (GRCh38)
Location 17:74252004-74252026 17:74252047-74252069
Sequence CCCAGCTCACAGTAAGTGCTCAG CCAAGAAGCCCCATTGTGTTAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 80, 3: 601, 4: 2215} {0: 1, 1: 0, 2: 1, 3: 11, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!