ID: 1151466468_1151466471

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1151466468 1151466471
Species Human (GRCh38) Human (GRCh38)
Location 17:74288975-74288997 17:74288996-74289018
Sequence CCCAGCTCTGGGGAATTCATTTC TCACTACCACGACTGACTTAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 232} {0: 1, 1: 0, 2: 0, 3: 0, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!