ID: 1151474905_1151474914

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1151474905 1151474914
Species Human (GRCh38) Human (GRCh38)
Location 17:74339801-74339823 17:74339845-74339867
Sequence CCGCGGTGCAGTGGTTGGGGGTG GGTCCAAAGGGACCTCAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 17, 4: 182} {0: 1, 1: 0, 2: 1, 3: 11, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!