ID: 1151480688_1151480689

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1151480688 1151480689
Species Human (GRCh38) Human (GRCh38)
Location 17:74368662-74368684 17:74368676-74368698
Sequence CCTGCTTGTGGGCTGCTCTGGTC GCTCTGGTCACTCTTCCTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 154} {0: 1, 1: 0, 2: 2, 3: 30, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!