ID: 1151493485_1151493493

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1151493485 1151493493
Species Human (GRCh38) Human (GRCh38)
Location 17:74446093-74446115 17:74446119-74446141
Sequence CCGCCAGGGAAGCCAGCAACTGT GCTGGGGGTATGGTAGTGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 211} {0: 1, 1: 0, 2: 0, 3: 22, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!