|
Left Crispr |
Right Crispr |
| Crispr ID |
1151498869 |
1151498875 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:74476060-74476082
|
17:74476086-74476108
|
| Sequence |
CCTCCAAGCTTTGGTGTCCAGAG |
TTATTGGGGTTTCATTACATAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 15, 3: 25, 4: 221} |
{0: 5, 1: 24, 2: 67, 3: 209, 4: 642} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|