ID: 1151515530_1151515535

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1151515530 1151515535
Species Human (GRCh38) Human (GRCh38)
Location 17:74592583-74592605 17:74592632-74592654
Sequence CCATGAGGAGTGCAGGGAGAGGA GGACTCACACCCAGCCTTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 513} {0: 1, 1: 0, 2: 0, 3: 27, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!