ID: 1151539571_1151539587

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1151539571 1151539587
Species Human (GRCh38) Human (GRCh38)
Location 17:74758224-74758246 17:74758262-74758284
Sequence CCCGCCATCCGCTCCCTGGACTG TGGGGCGGCCACTTAGGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 188} {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!