ID: 1151541761_1151541778

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1151541761 1151541778
Species Human (GRCh38) Human (GRCh38)
Location 17:74768211-74768233 17:74768253-74768275
Sequence CCGCCTCCAGTGACACCAGCGAG GGGGGTGGCAACTGGGTTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 162} {0: 1, 1: 0, 2: 1, 3: 16, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!