ID: 1151545151_1151545159

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1151545151 1151545159
Species Human (GRCh38) Human (GRCh38)
Location 17:74788356-74788378 17:74788392-74788414
Sequence CCTGTGTCCTTGCAAGGTTGACG CTGTCCTTCCAGAGGCTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 80} {0: 1, 1: 0, 2: 1, 3: 37, 4: 360}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!