ID: 1151545473_1151545479

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1151545473 1151545479
Species Human (GRCh38) Human (GRCh38)
Location 17:74790369-74790391 17:74790390-74790412
Sequence CCTGGAGAGGCTCCCCGCAGATT TTCTGGCATTTCCTGCCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90} {0: 1, 1: 0, 2: 2, 3: 21, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!