ID: 1151549791_1151549796

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1151549791 1151549796
Species Human (GRCh38) Human (GRCh38)
Location 17:74815636-74815658 17:74815660-74815682
Sequence CCTTTCTTCTGTAAGTGCCATGT CTGTAGGGTTAGAACTGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 216} {0: 1, 1: 0, 2: 1, 3: 10, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!