ID: 1151562801_1151562810

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1151562801 1151562810
Species Human (GRCh38) Human (GRCh38)
Location 17:74879630-74879652 17:74879674-74879696
Sequence CCCACTCCAGGTGTCCTGGGACC TGTGTCACCCACCTCCCATGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 273} {0: 1, 1: 1, 2: 1, 3: 25, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!