ID: 1151572844_1151572849

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1151572844 1151572849
Species Human (GRCh38) Human (GRCh38)
Location 17:74935885-74935907 17:74935912-74935934
Sequence CCGCTCAGCGCCCGCAGTCGGTG GCCCACGGCGATGCCTCTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76} {0: 1, 1: 0, 2: 0, 3: 11, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!