ID: 1151572856_1151572865

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1151572856 1151572865
Species Human (GRCh38) Human (GRCh38)
Location 17:74935931-74935953 17:74935971-74935993
Sequence CCGGCCTCAGGTAAGCCCGGAGC AGCTTGCGCACCCCAGACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120} {0: 1, 1: 0, 2: 0, 3: 3, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!