ID: 1151582880_1151582888

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1151582880 1151582888
Species Human (GRCh38) Human (GRCh38)
Location 17:74990111-74990133 17:74990164-74990186
Sequence CCCAGAAATGGGAAAGGAGCCAG GCAGCTTCTTGAGAGAGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 356} {0: 1, 1: 1, 2: 2, 3: 33, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!