ID: 1151607097_1151607106

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1151607097 1151607106
Species Human (GRCh38) Human (GRCh38)
Location 17:75144720-75144742 17:75144755-75144777
Sequence CCCTCAACCTGCTGAATCTGAGG AGAGGGTGTGGAAACTGGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 302} {0: 1, 1: 0, 2: 2, 3: 29, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!