ID: 1151632667_1151632676

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1151632667 1151632676
Species Human (GRCh38) Human (GRCh38)
Location 17:75321537-75321559 17:75321574-75321596
Sequence CCCAGCGGCAATCCCTGAAGGGC GGGCGCCTCCCCTTTCCTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 67} {0: 1, 1: 0, 2: 0, 3: 9, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!