|
Left Crispr |
Right Crispr |
| Crispr ID |
1151635701 |
1151635710 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:75346378-75346400
|
17:75346418-75346440
|
| Sequence |
CCCAGCTACTCGGGGGGCTGAGG |
CCTGGGAGGCAGAAGTTGCAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 833, 1: 104670, 2: 290917, 3: 226845, 4: 121967} |
{0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|