|
Left Crispr |
Right Crispr |
| Crispr ID |
1151636767 |
1151636770 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:75354531-75354553
|
17:75354547-75354569
|
| Sequence |
CCCGCTCCTTGTAAGAATCTAAT |
ATCTAATGCCTGATGATCTGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 5, 2: 53, 3: 88, 4: 203} |
{0: 605, 1: 945, 2: 803, 3: 457, 4: 288} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|