ID: 1151653961_1151653973

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1151653961 1151653973
Species Human (GRCh38) Human (GRCh38)
Location 17:75486805-75486827 17:75486851-75486873
Sequence CCTGCAGGAATTGGGGTGGGGTA CAGCCCAGCTCCAAAAGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 172} {0: 1, 1: 0, 2: 5, 3: 24, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!