ID: 1151656040_1151656043

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1151656040 1151656043
Species Human (GRCh38) Human (GRCh38)
Location 17:75496456-75496478 17:75496472-75496494
Sequence CCGGCTTATCGAACAGGTGGGTG GTGGGTGCTTCGGCAGGCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 45} {0: 1, 1: 0, 2: 0, 3: 3, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!