ID: 1151668283_1151668298

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1151668283 1151668298
Species Human (GRCh38) Human (GRCh38)
Location 17:75557971-75557993 17:75558016-75558038
Sequence CCCCAGGGCCAGGGCTGCTGTGT TGCATGGGTCCTGCTGCCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 531} {0: 1, 1: 0, 2: 0, 3: 35, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!