ID: 1151668288_1151668302

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1151668288 1151668302
Species Human (GRCh38) Human (GRCh38)
Location 17:75557996-75558018 17:75558022-75558044
Sequence CCTCCCCACCCTAGGCTCCATGC GGTCCTGCTGCCTCGGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 357} {0: 1, 1: 0, 2: 1, 3: 21, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!