ID: 1151668289_1151668301

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1151668289 1151668301
Species Human (GRCh38) Human (GRCh38)
Location 17:75557999-75558021 17:75558021-75558043
Sequence CCCCACCCTAGGCTCCATGCATG GGGTCCTGCTGCCTCGGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 203} {0: 1, 1: 0, 2: 4, 3: 48, 4: 557}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!