ID: 1151674993_1151675007

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1151674993 1151675007
Species Human (GRCh38) Human (GRCh38)
Location 17:75592681-75592703 17:75592733-75592755
Sequence CCAGGCCTGCAGGCTGCAAGGCA CTGAAGGCACTGCAGGGGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 362} {0: 1, 1: 0, 2: 3, 3: 32, 4: 354}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!