ID: 1151678098_1151678103

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1151678098 1151678103
Species Human (GRCh38) Human (GRCh38)
Location 17:75610230-75610252 17:75610244-75610266
Sequence CCCCTGCTCCAGAGGCGGCAGAG GCGGCAGAGACTGCAGGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 262} {0: 1, 1: 0, 2: 2, 3: 30, 4: 414}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!